The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy
نویسندگان
چکیده
Analysis of non-halal components, such as pork and porcine gelatin, in food pharmaceutical products is a need for halal authentication study. This research was aimed to develop species-specific primer (SSP) analyze DNA gelatin soft candy using real-time PCR. The SSP designed NCBI Primer-BLAST software. subjected validation by assessing some parameters, including specificity, sensitivity, repeatability test, linearity. results showed that the PCR with targeting on mitochondrial D-loop specifically able identify presence at an optimum annealing temperature 50.5 °C. coefficient variation (CV) analysis Cq 0.53%, efficiency value (E) amplification 100%. Real-time D-LOOP (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used identification candy.
منابع مشابه
Species Specific DNA Profiling Mycobacterial Genomes Using Polymerase Chain Reaction with Single Universal Primer (UP-PCR)
Three tuberculous, twenty-one non-tuberculous mycobacterial (NTM) reference strains and seventy two isolates classified by biochemical tests were shown to produce specific sets of DNA fragments in a polymerase chain reaction with single universal primer (UP-PCR). A rather wide limit of tolerance for variations in procedure of PCR mixture preparation and thermocycling parameters was found. There...
متن کاملDevelopment of New Modified Simple Polymerase Chain Reaction and Real-time Polymerase Chain Reaction for the Identification of Iranian Brucella abortus Strains
Brucellosis is primarily a worldwide zoonotic disease caused by Brucella species. The genus Brucella contains highly infectious species that are classified as biological threat agents. In this regard, the identification of Brucella can be a time-consuming and labor-intensive process posing a real risk of laboratory-acquired infection to the laboratory staff. This stud...
متن کاملPolymerase chain reaction assay targeting nox gene for rapid identification of Brachyspira canis in dogs
Genus Brachyspira,as Gram negative anaerobic bacteria, colonize in dogs intestine. The aim of the current study was to determine the prevalence of Brachyspira spp. for the first time in Iran and rapid identification of Brachyspira spp. in dogs by a new designment of a species-specific primer set for B. canis. One hundred fifty-one fecal samples were obtained ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Indonesian Journal of Chemistry
سال: 2021
ISSN: ['2460-1578', '1411-9420']
DOI: https://doi.org/10.22146/ijc.60413